rs1840817 chr19:28239467 G>A
- Sequence
aaccgcagtcccctccttgcaaga[G/A]gcccaggacctcagccaccaccag
- ASB in cell types
- LNCaP (prostate carcinoma) OCI-LY1 (diffuse large B-cell lymphoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 1.71 | -0.73 | 1.00 | |||
| OCI-LY1 (diffuse large B-cell lymphoma) | -2.48 | 2.73 | 1.00 | |||
| K562 (myelogenous leukemia) | 1.13 | 0.83 | 2.00 |
Items per page:
1 – 3 of 3