rs184105 chr5:56357764 C>A
- Sequence
tagaaaaaaatctatgtattttga[C/A]tgctgatataatgaagatcaaagc
- ASB in cell types
- BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- RARA_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | 1.97 | 0.10 | 1.00 | n/a | No Hit | |||
| GCR_HUMAN | -0.01 | 1.02 | 1.92 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, diabetic retinopathy in type 2 diabetes mellitus, fasting blood glucose, waist hip ratio