rs1842381 chr4:121718150 C>G
- Sequence
aactaagcaaaaagtgtctgaata[C/G]agcagaggttttgcaatcttaaaa
- ASB in cell types
- SUM159PT (Triple negative breast cancer)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SUM159PT (Triple negative breast cancer) | 2.11 | 0.06 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, college completion, height, microalbuminuria, obesity with early age of onset (age >2)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Thyroid