rs1845243 chr1:94697937 A>G
- Sequence
ctttgaggaaacacacttgtggat[A/G]attaacattgttaagagagtagtt
- ASB in cell types
- HepG2 (hepatoblastoma) embryonic stem cells derived definitive endoderm
- ASB for transcription factors
- TBX3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBX3_HUMAN | -1.40 | 2.55 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1