rs1848350 chr15:62391808 G>A
- Sequence
tgccgccttcctctgtcccgcctg[G/A]acccggccttggggctccgaggct
- ASB in cell types
- T47D (invasive ductal carcinoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.11 | 1.29 | 1.97 | |||
| K562 (myelogenous leukemia) | 0.15 | 1.16 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg