rs1850420 chr6:58290886 G>A
- Sequence
ccacagtctatctagatacttaaa[G/A]gaattatgtgatggattaagctaa
- ASB in cell types
- D283 Med (medulloblastoma)
- ASB for transcription factors
- OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | 2.04 | -3.77 | 1.50 | -0.49 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Colon_Sigmoid, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Thyroid