rs1853602 chr9:80886120 C>T
- Sequence
cagtgtctcggcgtattgacttgc[C/T]ctgcacatagggcaatgaacctat
- ASB in cell types
- H929 (plasma cell myeloma) gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 2.06 | n/a | 1.00 | |||
| gastroesophageal sphincter | -0.92 | 1.54 | 1.00 |
Items per page:
1 – 2 of 2