rs1856363 chr6:140979939 A>G
- Sequence
gagccttgagacctggttctgcca[A/G]ggaacaggaaaccagaactcatgg
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- NOTC1_HUMAN MBD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NOTC1_HUMAN | n/a | 0.87 | 2.00 | n/a | n/a | |||
| MBD4_HUMAN | 1.81 | -1.05 | 1.17 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP age-related macular degeneration, body mass index (bmi), height, infant head circumference, irritible bowel syndrome, ldl cholesterol, ldl cholesterol change with statins, obesity with early age of onset (age >2), partial epilepsy, schizophrenia, total cholesterol, total cholesterol change with statins