rs1856404 chr1:99759050 C>G
- Sequence
ttaagatgtttatcaagacaatac[C/G]tgcacggctgaacatagaccctta
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- MITF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MITF_HUMAN | -4.66 | 2.25 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Small_Intestine_Terminal_Ileum, Whole_Blood