rs1856780 chr1:19549189 C>A
- Sequence
gggaggccgaggcaggtgaatcac[C/A]tgaggtcatgagtttgagaccaac
- ASB in cell types
- TMD8 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TMD8 (diffuse large B-cell lymphoma) | -1.62 | 2.39 | 2.00 |
Items per page:
1 – 1 of 1