rs1858086 chr5:58498469 C>T
- Sequence
tcctggctggagatgtaaatttga[C/T]agtcatgagcatttaggtggtatt
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) GM10847 (female B-cells Lymphoblastoid Cell Lines) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 0.12 | 2.19 | 1.00 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | -1.24 | 1.73 | 1.00 | |||
| foreskin keratinocyte | 0.69 | n/a | 2.50 |
Items per page:
1 – 3 of 3