rs18582 chr1:85329136 A>G
- Sequence
atgtccggaggtgactacaaagca[A/G]aagcatggaatgtcatacattcca
- ASB in cell types
- HepG2 (hepatoblastoma) HAEC (human aortic endothelial cells)
- ASB for transcription factors
- JUN_HUMAN TF65_HUMAN ANM1_HUMAN NOTC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 3.60 | 0.14 | 1.33 | n/a | No Hit | |||
| TF65_HUMAN | 1.99 | -4.70 | 2.33 | n/a | No Hit | |||
| ANM1_HUMAN | 1.99 | -0.25 | 2.00 | n/a | n/a | |||
| NOTC1_HUMAN | 0.87 | -0.77 | 2.00 | n/a | n/a | |||
| IRF2_HUMAN | 2.49 | -2.03 | 1.00 | -3.06 | Concordant |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, biploar disorder (bipolar schizoaffective disorder), hdl cholesterol, ldl cholesterol, neuroblastoma (brain cancer), stabilized warfarin dose, tardive dyskinesia, urinary albumin-to-creatinine ratio
GTEx eQTL Adrenal_Gland, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Liver, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood