rs1858385 chr3:62673983 T>C
- Sequence
tacctctaatcaaatcgaatgctt[T/C]tgctaaaaaatacctgctctttat
- ASB in cell types
- germinal center B-cells
- ASB for transcription factors
- MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | 2.67 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP major depressive disorder (citalopram treatment remission), major depressive disorder (citalopram treatment response), partial epilepsy, premature ovarian failure, schizophrenia, tetrology of fallot, waist hip ratio