rs1858783 chr11:65275470 A>G
- Sequence
tggagtcatttcctttgaaaatgt[A/G]tggtagactttgccaaagtaagta
- ASB in cell types
- K562 (myelogenous leukemia) HUVEC-C (HUVEC, umbilical vein endothelial cells) BEAS-2B (bronchial epithelium) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- NCOR1_HUMAN TF65_HUMAN GCR_HUMAN TAL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NCOR1_HUMAN | 0.26 | 3.02 | 2.00 | n/a | n/a | |||
| TF65_HUMAN | 1.81 | 1.44 | 3.70 | n/a | No Hit | |||
| GCR_HUMAN | 0.39 | 1.11 | 1.35 | n/a | No Hit | |||
| TAL1_HUMAN | -0.05 | 1.65 | 1.67 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood