rs1858942 chr7:20596885 G>A
- Sequence
gtcatatgccaggcatcagcatga[G/A]ttatccatacagtaggctaagcac
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- FOS_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOS_HUMAN | 1.60 | -0.42 | 1.00 | -2.49 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), asthma, comorbid depressive syndrome and alcohol dependence, dengue shock syndrome in adolescents, mitral annular calcium, spine bone mineral density (bmd)