rs1859168 chr7:27202740 A>C
- Sequence
ctctcgccaagaaaaagcttgggg[A/C]ctgaattcttgagatttatggtgc
- ASB in cell types
- neural progenitors
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 2.56 | 0.07 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder in alcoholics, bipolar disorder in non-alcoholics, body mass index (bmi), diastolic blood pressure (dbp), ldl cholesterol, microalbuminuria, refractive error, systolic blood pressure (sbp), total cholesterol, urinary albumin-to-creatinine ratio