rs1860217 chr22:30289571 G>C
- Sequence
gggaggcggggcggcgggggtggt[G/C]cccgagccttaaaggagccgctgc
- ASB in cell types
- HEK293 (embryonic kidney) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- MAZ_HUMAN ANDR_HUMAN KLF10_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAZ_HUMAN | 3.19 | n/a | 2.00 | -1.69 | Weak Concordant | |||
| ANDR_HUMAN | 2.24 | -4.71 | 2.00 | n/a | No Hit | |||
| KLF10_HUMAN | 1.71 | n/a | 2.00 | -1.34 | Weak Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood