rs1860413 chr17:61437100 T>G
- Sequence
tatgtttcttatgtttagtgtcct[T/G]tcattcctcctccttcttcttctt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.44 | 0.55 | 5.43 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, chronic kidney disease, hdl cholesterol, height, late onset alzheimers disease, primary rhegmatogenous retinal detachment, rheumatoid arthritis, tetrology of fallot, total cholesterol