rs1860509 chr7:139778376 T>G
- Sequence
gcgtgtgtgcccaggtgcgagggt[T/G]cgcgcgtgtgctggcggggaggga
- ASB in cell types
- HCT-116 (colon carcinoma) neural cell 2588 (Lymphoblastoid Cell Lines) HEK293 (embryonic kidney)
- ASB for transcription factors
- TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | 0.13 | 1.80 | 1.20 | n/a | No Hit |
Items per page:
1 – 1 of 1