rs1860545 chr12:6337611 G>A
- Sequence
ccctcccgtgaagccaccattgac[G/A]atgtctgtttcctccaccccggct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MOLT-4 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.88 | 0.63 | 1.02 | |||
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 1.13 | 0.21 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
EMBL-EBI alopecia areata, ankylosing spondylitis, chronic inflammatory diseases (ankylosing spondylitis, crohns disease, psoriasis, primary sclerosing cholangitis, ulcerative colitis) (pleiotropy)
GRASP alzheimers disease, diastolic blood pressure (dbp), fasting insulin, homa-b, primary biliary cirrhosis, primary biliary cirrhosis (anti-mitochondrial antibody positive), primary biliary cirrhosis in females