rs1861367 chr12:97404784 G>A
- Sequence
agttcctgggtaaatagccttttg[G/A]ataatggccattttgaccaggctt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12892 (female B-cells lymphoblastoid cell line) GM18505 (female B-cells Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi)
- ASB for transcription factors
- FOXA1_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 1.44 | -0.14 | 2.12 | n/a | No Hit | |||
| STAG1_HUMAN | 1.54 | 1.15 | 1.08 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, cystatin c in serum, fasting blood glucose, homa-b, rheumatoid arthritis, tardive dyskinesia, years of education