rs1861423 chr14:76720718 G>T
- Sequence
gaaaatcagaccggaggagaggaa[G/T]gaaatgagtaactaattctgaaat
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) MV-4-11 (Childhood acute monocytic leukemia) GM12878 (female B-cells lymphoblastoid cell line) monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN CDK9_HUMAN FLI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 3.05 | 0.01 | 1.32 | -4.13 | Concordant | |||
| CDK9_HUMAN | 3.64 | -3.43 | 1.00 | n/a | n/a | |||
| FLI1_HUMAN | 4.42 | 0.38 | 1.33 | -4.79 | Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Pituitary, Small_Intestine_Terminal_Ileum, Testis, Thyroid, Whole_Blood