rs1861474 chr17:57627104 A>G
- Sequence
acccttaataaaaaaaccctcatg[A/G]gagacaaattattctgtgaaggaa
- ASB in cell types
- SK-N-SH (neuroblastoma)
- ASB for transcription factors
- COE3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COE3_HUMAN | -5.17 | 2.99 | 2.00 | 1.29 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP body mass index (bmi), hdl cholesterol, ldl cholesterol change with statins, neuroblastoma (brain cancer), refractive error, total cholesterol change with statins