rs186154 chr3:60319387 A>G
- Sequence
aggatctgctgacaagttctgatc[A/G]atatgtataattgatttttgctgc
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.39 | 1.39 | 1.22 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, hypertension (early onset hypertension), variant creutzfeldt-jakob disease