rs1861979 chr2:161989055 T>C
- Sequence
gagtttgttgaggcttaaagcctg[T/C]aagcaccaaaaaaaaaagttttct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | -0.04 | 2.29 | 1.25 |
Items per page:
1 – 1 of 1