rs1862026 chr12:105970965 T>G
- Sequence
ttggcttctatgctgacaagtgcc[T/G]tcatgcctgctttgctgccaaggc
- ASB in cell types
- MCF10A (breast epithelial cells)
- ASB for transcription factors
- P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P63_HUMAN | -0.52 | 1.56 | 1.07 | 2.68 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
