rs1862385 chr5:158911389 T>C
- Sequence
gtttacttctatcactaaccagcc[T/C]ggctggttacagctagctacacta
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.51 | 0.83 | 1.11 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), fasting insulin, homa-b, refractive error, salmonella-induced pyroptosis, systolic blood pressure (sbp)