rs1862475 chr19:50639588 G>C
- Sequence
tggggatcggtgggcgaggggtgg[G/C]atacacccaggtgtttcgggaccc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.04 | 0.93 | 1.99 | |||
| HEK293 (embryonic kidney) | 0.07 | 0.77 | 1.70 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -1.49 | 1.98 | 1.00 |
Items per page:
1 – 3 of 3