rs1862509 chr19:6675219 A>G
- Sequence
tctgggagagtgaggtgaggctgc[A/G]ggagggcagaagggatgcaaatga
- ASB in cell types
- K562 (myelogenous leukemia) BEAS-2B (bronchial epithelium)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.30 | 0.64 | 1.99 | |||
| BEAS-2B (bronchial epithelium) | 1.23 | 0.35 | 1.00 |
Items per page:
1 – 2 of 2