rs1863267 chr15:47412403 C>G
- Sequence
ttgacttttggcaggatctccaac[C/G]tgagcatatgccagttgacatggg
- ASB in cell types
- 22RV1 (prostate carcinoma) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.54 | -4.37 | 2.00 | |||
| VCaP (prostate carcinoma) | -0.07 | 1.31 | 2.00 |
Items per page:
1 – 2 of 2