rs1864078 chr19:40598852 G>C
- Sequence
cggggttctagattcccagacagt[G/C]cgggcttagaaatgctcttagaaa
- ASB in cell types
- THP-1 (acute monocytic leukemia) GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.81 | 0.80 | 1.02 | |||
| GBM39 (Human brain tumor) | 1.07 | -0.40 | 1.00 |
Items per page:
1 – 2 of 2