rs1864167 chr14:81170730 G>A
- Sequence
cgaatacaaaataccaaagagcca[G/A]cgctgagtcagagcctgccggcaa
- ASB in cell types
- A549 (lung carcinoma) HeLa (cervical adenocarcinoma) MCF7 (Invasive ductal breast carcinoma) THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.94 | 0.29 | 1.98 | |||
| HeLa (cervical adenocarcinoma) | 1.34 | -3.00 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.45 | 0.09 | 1.41 | |||
| THP-1 (acute monocytic leukemia) | 0.81 | 0.89 | 1.01 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP college completion, comorbid depressive syndrome and alcohol dependence, eye color, fasting insulin, homa-b, mitral annular calcium, transmission distortion, years of education
GTEx eQTL Adipose_Visceral_Omentum, Brain_Caudate_basal_ganglia, Brain_Hypothalamus, Esophagus_Mucosa, Esophagus_Muscularis, Lung