rs1864406 chr10:43105416 A>T
- Sequence
cctcgggaggcaaggaccaggacg[A/T]ggcccgagggctcgcgtctggggc
- ASB in cell types
- SK-N-SH (neuroblastoma) HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | 2.14 | -1.81 | 1.00 | |||
| HCT-116 (colon carcinoma) | -0.34 | 1.16 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg