rs1864492 chr2:73202680 G>C
- Sequence
acggccgcgtcatgcctagcccca[G/C]gccgcgaggcagcccgccacccgc
- ASB in cell types
- SMMC-7721 (hepatocellular carcinoma)
- ASB for transcription factors
- CATA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CATA_HUMAN | -3.13 | 2.01 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Cells_Cultured_fibroblasts, Colon_Sigmoid, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg