rs1865116 chr19:45791252 G>A
- Sequence
ggacggggcaaccacagacgggaa[G/A]gggacccaaatcacagacaagagt
- ASB in cell types
- macrophages form periferal blood monocyte-derived dendritic cells MOLT-4 (Adult T acute lymphoblastic leukemia) MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 3.06 | -2.93 | 2.00 | |||
| monocyte-derived dendritic cells | 1.53 | -0.45 | 1.17 | |||
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 1.61 | -0.44 | 1.00 | |||
| MDM(monocyte derived macrophages) | 1.18 | 3.50 | 2.14 | |||
| monocytes from periferal blood | 1.53 | 0.05 | 1.33 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, age at death with kuru exposure, fasting blood glucose, infant head circumference, irritible bowel syndrome, partial epilepsy, refractive error
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood