rs1865235 chr2:173402620 G>A
- Sequence
tctggaaaccggtcagtggccacc[G/A]aacgctgtttcaccgggtctagac
- ASB in cell types
- THP-1 (acute monocytic leukemia) HEK293 (embryonic kidney) hepatocytes HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.78 | 0.81 | 1.00 | |||
| HEK293 (embryonic kidney) | 0.57 | 0.73 | 1.11 | |||
| hepatocytes | 1.34 | 0.41 | 1.00 | |||
| HepG2 (hepatoblastoma) | 0.83 | 0.09 | 1.98 | |||
| KMS-11 (Plasma cell myeloma) | 1.29 | n/a | 3.00 |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GRASP college completion, panic disorder, primary rhegmatogenous retinal detachment, severe diabetic retinopathy, urinary albumin-to-creatinine ratio