rs1865550 chr8:130760753 T>C
- Sequence
tattacgagatgcagagagcatgc[T/C]ggaggcatctccataatatcacaa
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- GCR_HUMAN EP300_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | -1.37 | 1.41 | 1.55 | n/a | No Hit | |||
| EP300_HUMAN | -0.53 | 1.27 | 1.42 | n/a | n/a | |||
| JUN_HUMAN | 0.38 | 1.06 | 1.35 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), infant head circumference, parkinsons disease