rs1866883 chr11:71252087 T>A
- Sequence
gaaggggcaggacgcgccagagac[T/A]acgtggtccatgcgcgcaggagat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM18526 (B – cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -2.56 | 2.48 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Cells_EBV-transformed_lymphocytes, Muscle_Skeletal, Nerve_Tibial, Testis, Whole_Blood