rs1866901 chr2:41194454 T>C
- Sequence
ctccaaccacacagcacagacgac[T/C]gcacactgttctcctgaggcatgc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN NOTC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | -4.25 | 1.89 | 2.00 | n/a | No Hit | |||
| NOTC1_HUMAN | n/a | 2.09 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1 (in asthmatic participants), decrease in fev1 (in nonasthmatic and asthmatic participants), decrease in fev1 (in nonasthmatic participants), late onset alzheimers disease, mitral annular calcium