rs1867000 chr3:4826516 T>C
- Sequence
tggcttcccggtggctggaaacag[T/C]gtgtcagcgtcactggactcgccg
- ASB in cell types
- BEAS-2B (bronchial epithelium) upper lobe of left lung
- ASB for transcription factors
- GCR_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 3.30 | -0.43 | 1.00 | 0.27 | Weak Discordant | |||
| EP300_HUMAN | 2.46 | 0.00 | 1.67 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood