rs1868319 chr2:239035376 T>A
- Sequence
accactgtcacctccatcattggc[T/A]ggggtcagggtttgggaccagggc
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7L-P(immortalized breast epithelial cell line) | -0.43 | 1.65 | 1.50 |
Items per page:
1 – 1 of 1