rs1868520 chr3:42254729 A>G
- Sequence
caacaaaaaggaagcttctgagca[A/G]ccttaattggcagagctgaggaca
- ASB in cell types
- 22RV1 (prostate carcinoma) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.39 | n/a | 2.00 | |||
| LNCaP (prostate carcinoma) | 0.24 | 0.79 | 1.38 |
Items per page:
1 – 2 of 2