rs1868690 chr16:54288965 C>T
- Sequence
tagatccctccaggctccccaggc[C/T]tcgagcagaagcggcctcctggct
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | 1.66 | -1.25 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Minor_Salivary_Gland, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg