rs1868744 chr4:21780374 A>C
- Sequence
acagtttgcttgaaagtcccatga[A/C]taatcagcaaggcccattccatat
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | n/a | 3.48 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, arthritis including non-rheumatoid, birth weight, comorbid depressive syndrome and alcohol dependence, ldl cholesterol, partial epilepsy, resistance to kuru in aged women despite likely exposure, rheumatoid arthritis, sporadic creutzfeldt-jakob disease, variant creutzfeldt-jakob disease