rs1869144 chr15:58505101 G>A
- Sequence
agcacaggtccccagttttctggg[G/A]catctgaaacttgatgtgacagca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ZN687_HUMAN RELB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN687_HUMAN | 2.42 | -2.26 | 1.00 | n/a | n/a | |||
| RELB_HUMAN | 1.73 | -1.27 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), ldl cholesterol, parkinsons disease, salmonella-induced pyroptosis, serum creatinine, total cholesterol