rs1869514 chr2:38978655 C>T
- Sequence
ttttctgcttccctttcataaaac[C/T]tcaaagaggaaactgctccagttc
- ASB in cell types
- THP-1 (acute monocytic leukemia) TSU-1621-MT (adult acute myeloid leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.08 | 0.07 | 1.56 | n/a | No Hit |
Items per page:
1 – 1 of 1