rs1869710 chr19:40750470 C>T
- Sequence
aaggagtcaggaagtaaagtgcac[C/T]tcccactcccggaaaatggcggcc
- ASB in cell types
- MDM(monocyte derived macrophages) CTV-1 (Adult T acute lymphoblastic leukemia) CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.04 | n/a | 4.00 | 1.87 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP birth weight, comorbid depressive syndrome and alcohol dependence, total cholesterol, total cholesterol change with statins, triglycerides change with statins
GTEx eQTL Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood