rs1870031 chr3:66702137 C>G
- Sequence
aatgggttcagatggtttgaaagt[C/G]agcacactgggtcaagctgggtct
- ASB in cell types
- sigmoid colon
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| sigmoid colon | -2.08 | 2.14 | 1.25 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, cystatin c in serum, recurrent early onset major depressive disorder (females), recurrent early onset major depressive disorder (males), serum creatinine