rs1870033 chr3:66638942 C>A
- Sequence
atcatctttaatgttgtgtctctg[C/A]atgtcctgaaggaggtgctcaggc
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7L-P(immortalized breast epithelial cell line) | -0.94 | 2.24 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), comorbid depressive syndrome and alcohol dependence, fasting insulin, homa-ir