rs1870137 chr10:80510092 C>G
- Sequence
ctctcatgtgtggctgcacctgga[C/G]gcttggaccatagctgtcacagcc
- ASB in cell types
- NALM-6 (adult B acute lymphoblastic leukemia) HCASMC (Human coronary artery smooth muscle cells) EA.hy 926 (human umbilical vein endothelial cell line)
- ASB for transcription factors
- TCF21_HUMAN HIF1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | n/a | 3.36 | 3.00 | n/a | No Hit | |||
| HIF1A_HUMAN | 0.24 | 2.80 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. controls), birth weight, ldl cholesterol, rheumatoid arthritis, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood